Domain: bioboard.de

Overview
Ads (0)
PPC Keywords (0)
Organic Keywords (24)
Competitors (668)
Sub-Domains
bioboard.de
Paid Keywords
Keywords found: 0
#Competitors: 0
#Ad Copies: N/A
 
Organic Keywords
Keywords found: 24
#Competitors: 679
Average Position: N/A
 
PPC Overview
No Results Found
Organic Listing Variations
1.
Giftigkeit von Ethanol
- [ Translate this page ]11 posts - 3 authors - Last post: Jun 21, 2008Dieser wird wiederum als Gift deklariert. Und da wirklich das Ethanol und nicht eines der Abbauprodukte. Wie wirkt dieses Gift? ...
2.
Chromosomensatz
- [ Translate this page ]3 posts - 3 authors - Last post: Sep 14, 2004hier findest du die benötigten Infos: Chromosomensatz ... Der Chromosomensatz ist die Gesamtheit aller Chromosomen in der Zelle. ...
3.
Alle mögl. Erbgänge
- [ Translate this page ]6 posts - 4 authors - Last post: Apr 11, 2005Könnte mir jemand von euch eine Liste geben bzw. machen, in der alle Erbgänge die es gibt erfasst werden (+Beschreibungen). ...
4.
Warum der offene Blutkreislauf der Insekten?
- [ Translate this page ]4 posts - 3 authors - Last post: Jan 11, 2006Den geschlossenen Blutkreislauf findet man erst bei den höheren Tieren. Dazu nutzt es vielleicht etwas sich die evolutionäre ...
5.
Proteinbiosynthese Codesonne
- [ Translate this page ]3 posts - 2 authors - Last post: Nov 20, 2008(Hinweis:mRNA, Codesonne) 3´ ATACGGCACCAAGGTGATAACTAGG 5´ Da habe ich mir gedacht, dass das eventuell die Lösung sein könnte: ...
6.
Facharbeit Biologie
- [ Translate this page ]3 posts - 3 authors - Last post: Feb 13, 2006Ich würde gern eine Facharbeit in Biologie über ein psychologisches Thema schreiben, wie zum Beispiel Aggressiontheorien oder Lernverhalten ...
7.
Facharbeit Biologie
- [ Translate this page ]3 posts - 3 authors - Last post: Feb 13, 2006Ich würde gern eine Facharbeit in Biologie über ein psychologisches Thema schreiben, wie zum Beispiel Aggressiontheorien oder Lernverhalten ...
8.
Facharbeit Biologie
- [ Translate this page ]3 posts - 3 authors - Last post: Feb 13, 2006Ich würde gern eine Facharbeit in Biologie über ein psychologisches Thema schreiben, wie zum Beispiel Aggressiontheorien oder Lernverhalten ...
9.
Facharbeitsthema: Schlaf
- [ Translate this page ]15 posts - 9 authors - Last post: Feb 27, 2006Facharbeitsthema: Schlaf Gehe zu Seite 1, 2 Weiter ... Verfasst am: 14. Feb 2006 17:58 Titel: Facharbeitsthema: Schlaf, Antworten mit Zitat ...
10.
Evolution: homologe Organe, ...
- [ Translate this page ]5 posts - 5 authors - Last post: May 3, 2006Homologe Organe nehmen bei verschieden Lebewesen die gleich Lage ein und weisen den gleichen Grundbauplan auf. ...
 
View More »
ascSort Ascending
descSort Descending
eqEquals...
!eqDoes Not Equal...
gtGreater Than...
gteqGreater Than or Equal To...
ltLess Than...
lteqLess Than or Equal To...
      And   Or
                
Sometimes you don’t know exactly what you are looking for in a Research data. That’s when our searching options may come handy.
The Domain Search
This search allows you to enter the domain name of the site you want to analyze. For example, you may enter “amazon.com” in the KeywordSpy search bar.

The Keyword Search
This will let you enter terms and key phrases in the search bar such as “send flowers”, “cover letters”, “keyword software,” and even a single broad term like “chocolate”.

The Ad Copy Search
This allows you to enter any texts or content included in an ad copy, whether the ones in ad copy headline or the ones in description lines. For example: “sunglasses”.
The Destination URL Search
This search allows you to enter the destination URL of the site that you want to analyze.

The destination URL is the address where a searcher is taken when an advertisement copy in search engines is clicked. Please take note that the destination URL differs from the display URL which appears at the bottom of advertisement copies.

Please be reminded to always include http:// at the beginning of your Destination URL search. For example: “http://www.proflowers.com”.

In addition, if you want to find all the ads that KeywordSpy indexed for a specific affiliate network e.g. Hydra Network. You should search in Destination URL the string lynxtrack.com.
Loading
  Loading...